plko 1 puro lentiviral vector (Addgene inc)
96
Structured Review
Addgene inc
plko 1 puro lentiviral vector
Plko 1 Puro Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1565 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+plko/pLKO%2E1+puro+(Plasmid+%238453)/pm41922512-130-18-21
Average 96 stars, based on 1565 article reviews
Plko 1 Puro Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1565 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+vectors+plko/pLKO%2E1+puro+(Plasmid+%238453)/pm41922512-130-18-21
Average 96 stars, based on 1565 article reviews
plko 1 puro lentiviral vector - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Control:Article Title: The topology of the lymphotoxin β receptor that accumulates upon endolysosomal dysfunction dictates the NF-κB signaling outcome. Article Snippet: Generation of Rab7 depletion in HeLa cells with shRNA Small hairpin RNA (shRNA) targeting Rab7 (Primer sequence: Forward 5’- CCGGGTGTTGCTGAAGGTTATCACTGCAGTGATAACCTTCAGCAACACTTTTTG3’; Reverse 5’-AATTCAAAAAGTGTTGCTGAAGGTTATCACTGCAGTGATAACCTTCAG CAACAC-3’) was cloned into lentiviral vector pLKO.1 TRC cloning vector (Addgene #10878). .. shRNA:Article Title: The topology of the lymphotoxin β receptor that accumulates upon endolysosomal dysfunction dictates the NF-κB signaling outcome. Article Snippet: Generation of Rab7 depletion in HeLa cells with shRNA Small hairpin RNA (shRNA) targeting Rab7 (Primer sequence: Forward 5’- CCGGGTGTTGCTGAAGGTTATCACTGCAGTGATAACCTTCAGCAACACTTTTTG3’; Reverse 5’-AATTCAAAAAGTGTTGCTGAAGGTTATCACTGCAGTGATAACCTTCAG CAACAC-3’) was cloned into lentiviral vector pLKO.1 TRC cloning vector (Addgene #10878). .. Infection:Article Title: PHLDA1 Modulates the Endoplasmic Reticulum Stress Response and is required for Resistance to Oxidative Stress-induced Cell Death in Human Ovarian Cancer Cells. Article Snippet: .. Cells were infected by |