Review



plko 1 puro lentiviral vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc plko 1 puro lentiviral vector
    Plko 1 Puro Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1565 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vectors+plko/pLKO%2E1+puro+(Plasmid+%238453)/pm41922512-130-18-21
    Average 96 stars, based on 1565 article reviews
    plko 1 puro lentiviral vector - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Control:

    Article Title: The topology of the lymphotoxin β receptor that accumulates upon endolysosomal dysfunction dictates the NF-κB signaling outcome.
    Article Snippet: Generation of Rab7 depletion in HeLa cells with shRNA Small hairpin RNA (shRNA) targeting Rab7 (Primer sequence: Forward 5’- CCGGGTGTTGCTGAAGGTTATCACTGCAGTGATAACCTTCAGCAACACTTTTTG3’; Reverse 5’-AATTCAAAAAGTGTTGCTGAAGGTTATCACTGCAGTGATAACCTTCAG CAACAC-3’) was cloned into lentiviral vector pLKO.1 TRC cloning vector (Addgene #10878). .. Lentiviral vectors pLKO.1 - TRC control (Addgene #10879) and scramble shRNA (Addgene #1864) were used as controls. ..

    shRNA:

    Article Title: The topology of the lymphotoxin β receptor that accumulates upon endolysosomal dysfunction dictates the NF-κB signaling outcome.
    Article Snippet: Generation of Rab7 depletion in HeLa cells with shRNA Small hairpin RNA (shRNA) targeting Rab7 (Primer sequence: Forward 5’- CCGGGTGTTGCTGAAGGTTATCACTGCAGTGATAACCTTCAGCAACACTTTTTG3’; Reverse 5’-AATTCAAAAAGTGTTGCTGAAGGTTATCACTGCAGTGATAACCTTCAG CAACAC-3’) was cloned into lentiviral vector pLKO.1 TRC cloning vector (Addgene #10878). .. Lentiviral vectors pLKO.1 - TRC control (Addgene #10879) and scramble shRNA (Addgene #1864) were used as controls. ..

    Infection:

    Article Title: PHLDA1 Modulates the Endoplasmic Reticulum Stress Response and is required for Resistance to Oxidative Stress-induced Cell Death in Human Ovarian Cancer Cells.
    Article Snippet: .. Cells were infected by lentiviral vectors pLKO.1 encoding scrambled shctrl (Addgene, Cambridge, MA, USA) or one of the three PHLDA1-targeting shRNAs (all from Sigma, St. Louis, MO, USA): shPHLDA1-1 (CCG GCC TAA TCC GTA GTA ATT ..



    Similar Products

    96
    Addgene inc plko 1 puro lentiviral vector
    Plko 1 Puro Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vectors+plko/pLKO%2E1+puro+(Plasmid+%238453)/pm41922512-130-18-21
    Average 96 stars, based on 1 article reviews
    plko 1 puro lentiviral vector - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 puro lentiviral vectors
    Plko 1 Puro Lentiviral Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vectors+plko/pLKO%2E1+puro+(Plasmid+%238453)/bio_rxiv__64898__2026__03__21__713033-454-10-13
    Average 96 stars, based on 1 article reviews
    plko 1 puro lentiviral vectors - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Addgene inc transfection lentiviral vector plko 1 egfp puro
    Transfection Lentiviral Vector Plko 1 Egfp Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vectors+plko/pLKO%2E1+puro+(Plasmid+%238453)/pm41874277-297-2-13
    Average 96 stars, based on 1 article reviews
    transfection lentiviral vector plko 1 egfp puro - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Addgene inc lentiviral backbone vector plko 1
    Lentiviral Backbone Vector Plko 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vectors+plko/pLKO%2E1+puro+(Plasmid+%238453)/pmc12959293-96-1-5
    Average 96 stars, based on 1 article reviews
    lentiviral backbone vector plko 1 - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 lentiviral vector
    Plko 1 Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vectors+plko/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/pmc12929812-154-28-32
    Average 96 stars, based on 1 article reviews
    plko 1 lentiviral vector - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Addgene inc lentiviral vector plko 1 puro
    Lentiviral Vector Plko 1 Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vectors+plko/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/pm41603084-66-61-64
    Average 96 stars, based on 1 article reviews
    lentiviral vector plko 1 puro - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Addgene inc lentiviral vector plko
    Lentiviral Vector Plko, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vectors+plko/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/pmc12848531-56-16-19
    Average 96 stars, based on 1 article reviews
    lentiviral vector plko - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Addgene inc lentiviral vector plko 1 shrna control shctrl
    Lentiviral Vector Plko 1 Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vectors+plko/pLKO%2E1+-+TRC+control+(Plasmid+%2310879)/pm41596422-229-0-6
    Average 96 stars, based on 1 article reviews
    lentiviral vector plko 1 shrna control shctrl - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results